Citation
Fitriani N. E., . and Pratiwi D., . and Sudjadi, . and Rohman A., . Application of real-time polymerase chain reaction for analysis of porcine DNA in gelatine-containing capsule shell for halal authentication. pp. 1515-1519. ISSN 2231-754
Abstract
Gelatine used for capsule shells is made from porcine or bovine origins. Several methods for porcine DNA identification in numerous products have been reported for halal authentication. The negative results of a specific determination toward porcine DNA remained unclear whether negative results were caused no porcine DNA in product or due to the failure during DNA extraction therefore it is necessary to confirm the presence of bovine gelatine in capsule shell. The aim of this study is to confirm the bovine gelatine using specific primer from bovine D-loop. From two pair of primers designed only primer D-loop93 (F: ACACAGAATTTGCACCCTAA R: GTACATTACCCCTTGCGTAG) had the capability to identify bovine DNA either in fresh tissue or gelatine sources with the optimum annealing temperature of 51.4C. The limit of detection of DNA in gelatine is 5 pg. All commercial capsule shells were analyzed using primer D-loop 93 and the results showed that all commercial capsule shells are amplified.
Download File
Full text available from:
Official URL: http://www.ifrj.upm.edu.my/25%20(04)%202018/(26).p...
|
Abstract
Gelatine used for capsule shells is made from porcine or bovine origins. Several methods for porcine DNA identification in numerous products have been reported for halal authentication. The negative results of a specific determination toward porcine DNA remained unclear whether negative results were caused no porcine DNA in product or due to the failure during DNA extraction therefore it is necessary to confirm the presence of bovine gelatine in capsule shell. The aim of this study is to confirm the bovine gelatine using specific primer from bovine D-loop. From two pair of primers designed only primer D-loop93 (F: ACACAGAATTTGCACCCTAA R: GTACATTACCCCTTGCGTAG) had the capability to identify bovine DNA either in fresh tissue or gelatine sources with the optimum annealing temperature of 51.4C. The limit of detection of DNA in gelatine is 5 pg. All commercial capsule shells were analyzed using primer D-loop 93 and the results showed that all commercial capsule shells are amplified.
Additional Metadata
| Item Type: | Article |
|---|---|
| AGROVOC Term: | Polymerase chain reaction |
| AGROVOC Term: | DNA |
| AGROVOC Term: | Gelatine |
| AGROVOC Term: | Animal protein |
| AGROVOC Term: | Food composition |
| AGROVOC Term: | Bovines |
| Depositing User: | Ms. Suzila Mohamad Kasim |
| Last Modified: | 24 Apr 2025 06:29 |
| URI: | http://webagris.upm.edu.my/id/eprint/24657 |
Actions (login required)
![]() |
View Item |
